FAQ - STOmics

Q What is the best way to hadle areas of excessively high signal that impact judgment in the IF image?

A

There are two options.

Option 1: Avoid selecting fluorophores with overlapping wavelengths that may lead to spectral crossover;

Option 2: Replace a microscope to eliminate the risk of channel bleed through.

Q Why is a brief centrifugation recommended before adding primary, secondary antibodies and DAPI solutions?

A

Brief centrifugation prevents the pipetting of antibodies or dye aggregates that have formed during storage, which can lead to bright spots on the fluorescence image.

Q Can different antibodies be added in the mIF staining process? Which sources of antibodies have been tested so far?

A

The primary antibody should be mixed with different primary antibodies of different origins (primary antibody and secondary antibody should be of the same origin), and so far only primary antibodies of mouse/rabbit/rat origin have been tested.

Q What points should be considered before and after drawing hydrophobic circles on the microscopic glass slide with an immunohistochemistry pen?

A

Before drawing the hydrophobic circle, ensure the slide around the tissue is dry. You can use dust-free paper to gently wipe away any moisture from the slide.
Hold down the slide with one hand and draw the circle to prevent it from moving.
When adding liquid, make sure to add it inside the hydrophobic circle, just enough to cover the entire tissue.
Avoid adding too much liquid, as it may overflow the hydrophobic circle, making it difficult for the circle to contain the liquid within.
Be careful when suctioning and disposing of the liquid; do not suction outside the hydrophobic circle.
When disposing of the liquid, ensure you do not drop any liquid outside the hydrophobic circle and keep it dry.

Q When performing antibody titrations on microscopic glass slides, how many tissue sections can be mounted on one slide?

A

It is recommended to mount only one tissue section per microscopic glass slide to prevent the tissue from drying out during subsequent operations.

Q Can antibody titrations be done on used Stereo-seq Chips and how much reagent should be used?

A

Yes, antibody titration can be done on a previously used Stereo-seq chip to help one get familiarized with the actual experimental process ahead of time with 100 μL of antibody/blocking solution per chip.

Q Why is there a flipping problem using automatic registration?

A

● A flip problem can occur when the microscope photo picture of the tissue and the gene expression matrix are aligned, and the flip situation is related to the chip sequencing scheme and the image output of the microscope.

● SS chips start sequencing from the lower left corner during sequencing, the coordinate origin (0,0) of sequencing is in the lower left corner, and the coordinate origin of the imaging are in the upper left corner, so the image and expression matrix will be reversed by default in the automatic image process.

● However, after imaging, the output image may be in the same orientation as the image seen by the lens, or the output image may be mirrored with the orientation of the tissue seen by the lens due to the different configuration of the microscope's software.

● How to judge in advance whether the image output by your microscope needs to be flipped before QC/analysis?

○ The Stereo-seq technology uses a chip to capture, and the chip is opaque, so no matter whether the microscope is placed upright or inverted, the microscope needs the lens to take pictures of the tissue staining image. Therefore, when acquiring microscope images, as long as it is confirmed that the direction of the lens facing the tissue is consistent with the direction of the image output by the microscope software, and there is no mirror image, the problem of inversion and matching will not occur during registration.

● If there is a mirror image of the output image of the microscope and the orientation of the tissue on the chip, you can try to adjust the microscope configuration, or use PhotoShop, ImageJ and other image processing software to flip the image, and then QC.

翻转问题-配图

Q What does the overall image processing procedure of Stereo-seq analysis look like?

A

stereo-seq_image_processing_overview

Q Format and requirements of the original input FASTQ file to SAW.

A

STOmics SAW analysis process supports Q40 FASTQ and Q4 FASTQ files as input parameters.

Q40: A quality system that describes the quality of all sequenced bases with 41 quality values. Q40 FASTQ is the common form of PE FASTQ, with data appearing in pairs, usually named <lane>*_1.fq.gz and <lane>*_2.fq.gz. In general, the Q40 FASTQ file usually has a "read" field, such as lane_read_1.fq.gz and lane_read_2.fq.gz. In a few cases, there may be no "read" in the file name, then you can check whether it is in pairs, or check the file format.

## Q40 read 1
@V350156489L4C001R00100001484/1
TCTGCAGCCAACATGGACAGATCCTTTTAGAACTT
+
D>DC<CBEADEABCB(AADCDD2DD"DBE*$F'C'

## Q40 read 2
@V350156489L4C001R00100001484/2
CTATGAAACACACTATCCTCAATCGGCTCCTTAATTTCAATACCAGCCGT
+
ECFCCB?CAECEBDBCCFDFEFDF?<FCF>B?2EC=C?C<CE(AA=;B5B

Q4: A quality system that describes the quality of all sequenced bases with 4 quality values. Q4 FASTQ comes as a set of 16 or 64 individual files, usually named <Lane>_<barcode>_<splitIndex>.fq.gz. In a few cases, there may be no barcode in the file prefix, you may distinguish the barcode from the directory name as below. Although it's not accurate, Q4 FASTQ is previously often called SE FASTQ. In fact, it is still paired-end sequencing, but when FASTQ is written out of the machine after sequencing, it is output as a set of single files, which looks the same as SE data. This format encodes the information in read1 and writes it into the readID of read2. At the same time, the sequence quality information is recorded in the form of Q4 to reduce storage.

requirements

## Q4 read
@FP300000513L1C002R00400000218 CE242DF29A57 97D26
GTGTAGTGAACCCCATGGTAGTTTTCTGATTGTTGTTAAAAAAAATGACTTAACATATTACATGGACACTCAATAAAAATGTTTTATTTCCTGTTGAAAA
+
FFFFFFFFFFFF8F8FFFFFFFFFFFFF8FFFFFFFFF8FF8FFF8FFFFFFF,FFFFFFFFFFF8FFFFFF8F8F,F8FFFFFF,FFFFFFFFFF,FFF

Q Does the max length used for annotating alternative splicing sequences need to be consistent to the read length?

A

Does parameter --sjdOverhang used for STAR builds of reference genome indexes need to be consistent with the sequencing read length? If there are variable sequencing read lengths, e.g. 50bp, 100bp, 150bp, will SAW choose different STAR indices automatically during analysis?

At present, there's no distinct index built for different read lengths. Reference genomes used for submitted standard analysis tasks on the STOmic Cloud platform are uniformly built with the STAR default value for a read length of 100, that is --sjdOverhang 99.
Using the different lengths in genome indexing can specify the range of adjacent genome sequences around the annotated splicing sites, which is the maximum length used for identification of alternative transcript splicing.
The impact of using different lengths is limited to very few splicing sites that are susceptible to variation of several bases in the alignment of the regions around boundaries of exons/introns. The difference is marginal that there is no need to have a distinct index for each read length.

Reference material: