For Stereo-seq mIF experiments, Triton X-100, which may affect cell permeability, is added into blocking solution for antibody incubation before permeabilization; thus, the permeabilization time of should be specifically optimized.

There are two options.

Option 1: Avoid selecting fluorophores with overlapping wavelengths that may lead to spectral crossover.

Option 2: Replace a microscope to eliminate the risk of channel bleed-through.

1. Preparing the Slide: Before drawing the hydrophobic circle, ensure the area around the tissue is completely dry. Use dust-free paper to gently wipe away any liquid from the slide.

2. Drawing the Circle: While drawing the circle, hold the slide firmly with one hand to prevent it from moving.

3. Adding liquid: When adding liquid, ensure it is dispensed entirely within the hydrophobic circle, covering the entire tissue. Avoid adding excess liquid, as it may flow outside the circle, making it difficult for the liquid to aggregate within the circle. 4. Removing liquid: place the glass slide on the bench and aspirate most of the liquid out from the tissue, and tilt the glass slide to remove the remaining with dust-free paper.

STOmics SAW analysis process supports paired FASTQ and group FASTQ files, and suppports Q40 and Q4 quality systems.

• Paired FASTQs include a pair of read files, read 1 for CID, MID information and read 2 for captured RNA sequencing data respectively. An example of paired FASTQ

• # read 1
  @E100026571L1C001R00300000000/1
  TGTCCAACGGAGACGGCTCCGACAAGGCACTGGCA
  +
  >DG;<BGH=>*EFE8*G/3E@2:F0-GBGG188F<
  
  # read 2
  @E100026571L1C001R00300000000/2
  GTCTCACCATACTTTTACAAAGTTATTTCAACCCAAATCACAATTTAAGAATTATTTGTTCTACCTATGCCACACTTTAAATAAATGTCTATTAAAACCA
  +
  -GFEECG?ECBFF<=@A@<E@><;FGCF=>=E53FEF5>FGF@,0ADE9CEAG2GBE@HF3EA<CE;G2F@=G8=?@G9FBGE.EG6G2;974E*D9DE9

• Grouped-FASTQ is an output format with only one read file split from a dataset (containing 16 or 64 parts in a group). Read ID in the file starts with "@" and includes the read name and encoded CID and MID information. The sequence part contains captured RNA sequencing data. The file storage space is greatly reduced because of the combined output format and fewer quality values. An example of grouped FASTQ:

@FP300000513L1C002R00400000218 CE242DF29A57 97D26
GTGTAGTGAACCCCATGGTAGTTTTCTGATTGTTGTTAAAAAAAATGACTTAACATATTACATGGACACTCAATAAAAATGTTTTATTTCCTGTTGAAAA
+
FFFFFFFFFFFF8F8FFFFFFFFFFFFF8FFFFFFFFF8FF8FFF8FFFFFFF,FFFFFFFFFFF8FFFFFF8F8F,F8FFFFFF,FFFFFFFFFF,FFF