FAQ - STOmics

Q How to avoid fluorophore bleed-through when multiple fluorophores are applied in my Stereo-seq mIF transcriptomics experiment?

A

There are two options.

Option 1: Avoid selecting fluorophores with overlapping wavelengths that may lead to spectral crossover.

Option 2: Replace a microscope to eliminate the risk of channel bleed-through.

Q Why is a brief centrifugation recommended before adding primary, secondary antibodies and DAPI solutions?

A

Brief centrifugation prevents the pipetting of antibodies or dye aggregates that have formed during storage, which can lead to bright spots on the fluorescence image.

Q What are the key points for selecting multiple primary antibodies in Stereo-seq mIF application? Which sources of antibodies have been tested so far?

A

Primary antibodies of different host species should be selected for mixture. Secondary antibody selection depends on the host species of the target primary antibody. So far, only primary antibodies sourced from mouse, rabbit and rat have been tested.

Q What are the key points for drawing hydrophobic circles on the microscopic glass slide with an immunohistochemistry pen?

A

Preparing the Slide: Before drawing the hydrophobic circle, ensure the area around the tissue is completely dry. Use dust-free paper to gently wipe away any liquid from the slide.
Drawing the Circle: While drawing the circle, hold the slide firmly with one hand to prevent it from moving.
Adding liquid: When adding liquid, ensure it is dispensed entirely within the hydrophobic circle, covering the entire tissue. Avoid adding excess liquid, as it may flow outside the circle, making it difficult for the liquid to aggregate within the circle. 4. Removing liquid: place the glass slide on the bench and aspirate most of the liquid out from the tissue, and tilt the glass slide to remove the remaining with dust-free paper.

Q When performing antibody titrations on microscopic glass slides, how many tissue sections can be mounted on one slide?

A

For easier operation, it is recommended to mount only one tissue section per microscopic glass slide.

Q Can antibody titrations be done on used Stereo-seq Chips and how much reagent should be used?

A

Yes, antibody titration can be done on a previously used Stereo-seq chip to help users get familiarized with the transcriptomics experimental workflow with 100 μL of antibody/blocking solution applied per chip.

Q Why is there a flipping problem using automatic registration?

A

A flip problem can occur when the microscope photo picture of the tissue and the gene expression matrix are aligned, and the flip situation is related to the chip sequencing scheme and the image output of the microscope. SS chips start sequencing from the lower left corner during sequencing, the coordinate origin (0,0) of sequencing is in the lower left corner, and the coordinate origin of the imaging are in the upper left corner, so the image and expression matrix will be reversed by default in the automatic image process.
However, after imaging, the output image may be in the same orientation as the image seen by the lens, or the output image may be mirrored with the orientation of the tissue seen by the lens due to the different configuration of the microscope's software.
How to judge in advance whether the image output by your microscope needs to be flipped before QC/analysis? The Stereo-seq technology uses a chip to capture, and the chip is opaque, so no matter whether the microscope is placed upright or inverted, the microscope needs the lens to take pictures of the tissue staining image. Therefore, when acquiring microscope images, as long as it is confirmed that the direction of the lens facing the tissue is consistent with the direction of the image output by the microscope software, the issue of mirrorring between registered image and heatmap will not occur in the auto-registration.
If there is a mirror image of the output image of the microscope and the orientation of the tissue on the chip, you can try to 1) adjust the microscope configuration to prevent image inversion, or 2) use PhotoShop, ImageJ and other image processing software to flip the image, and then QC.
For more information about image processing, please refer to this blog: https://en.stomics.tech/news/stomics-blog/1123.html

翻转问题EN

翻转问题-配图

Q What does the overall image processing procedure of Stereo-seq analysis look like?

A

The image processing workflow is slightly updated after SAW v8.0/StereoMap v4.0.

SAW >= v8.0, StereoMap >= v4.0 (Current)

The major image processing steps are: Image registration (including pre-registration) -> Tissue segmentation -> Cell Segmentaion -> Cell border correction -> Extracting gene expression data

Stereo-seq_image_processing_overview_v2 (SAW >=8.0)

SAW < v8.0, StereoMap < v4.0, ImageStudio <= 3.0

The major image processing steps are: Image pre-registration -> Tissue segmentation -> Cell Segmentaion -> Image registration -> Cell border correction -> Extracting gene expression data

Stereo-seq_image_processing_overview_v1 (SAW <8.0)

Q Format and requirements of the original input FASTQ file to SAW.

A

STOmics SAW analysis process supports paired FASTQ and group FASTQ files, and suppports Q40 and Q4 quality systems.

Paired FASTQs include a pair of read files, read 1 for CID, MID information and read 2 for captured RNA sequencing data respectively. An example of paired FASTQ

# read 1
@E100026571L1C001R00300000000/1
TGTCCAACGGAGACGGCTCCGACAAGGCACTGGCA
+
>DG;<BGH=>*EFE8*G/3E@2:F0-GBGG188F<

# read 2
@E100026571L1C001R00300000000/2
GTCTCACCATACTTTTACAAAGTTATTTCAACCCAAATCACAATTTAAGAATTATTTGTTCTACCTATGCCACACTTTAAATAAATGTCTATTAAAACCA
+
-GFEECG?ECBFF<=@A@<E@><;FGCF=>=E53FEF5>FGF@,0ADE9CEAG2GBE@HF3EA<CE;G2F@=G8=?@G9FBGE.EG6G2;974E*D9DE9

Grouped-FASTQ is an output format with only one read file split from a dataset (containing 16 or 64 parts in a group). Read ID in the file starts with "@" and includes the read name and encoded CID and MID information. The sequence part contains captured RNA sequencing data. The file storage space is greatly reduced because of the combined output format and fewer quality values. An example of grouped FASTQ:

@FP300000513L1C002R00400000218 CE242DF29A57 97D26
GTGTAGTGAACCCCATGGTAGTTTTCTGATTGTTGTTAAAAAAAATGACTTAACATATTACATGGACACTCAATAAAAATGTTTTATTTCCTGTTGAAAA
+
FFFFFFFFFFFF8F8FFFFFFFFFFFFF8FFFFFFFFF8FF8FFF8FFFFFFF,FFFFFFFFFFF8FFFFFF8F8F,F8FFFFFF,FFFFFFFFFF,FFF

For more information, please refer to [SAW User Manual > Analysis > Inputs > FASTQs].

Q Does the max length used for annotating alternative splicing sequences need to be consistent to the read length?

A

Does parameter --sjdOverhang used for STAR builds of reference genome indexes need to be consistent with the sequencing read length? If there are variable sequencing read lengths, e.g. 50bp, 100bp, 150bp, will SAW choose different STAR indices automatically during analysis?

At present, there's no distinct index built for different read lengths. Reference genomes used for submitted standard analysis tasks on the STOmic Cloud platform are uniformly built with the STAR default value for a read length of 100, that is --sjdOverhang 99.
Using the different lengths in genome indexing can specify the range of adjacent genome sequences around the annotated splicing sites, which is the maximum length used for identification of alternative transcript splicing.
The impact of using different lengths is limited to very few splicing sites that are susceptible to variation of several bases in the alignment of the regions around boundaries of exons/introns. The difference is marginal that there is no need to have a distinct index for each read length.

Reference material: