STOmics STOmics

EN CN
FAQ
Search
Filter Clear
Products
Stereo-seq Solutions
Stereo-seq Solution V1.3
Stereo-seq Solution V1.2
Stereo-seq Solution - mIF
Stereo-seq Large Chip Designs
Stereo-CITE Solution
Stereo-seq OMNI Solution
STOmics Software
Stereo-seq Analysis Workflow
StereoMap
Technical Process
Sample Preparation
Operating Procedure
Experimental Results
Image Process
Sequencing Analysis
Report Interpretation
105results:
Q If a fresh frozen sample has already been tested in the Stereo-seq Transcriptomics workflow with other staining methods (e.g., H&E or ssDNA), is it necessary to perform another permeabilization optimization experiment using the mIF protocol?
A

For Stereo-seq mIF experiments, Triton X-100, which may affect cell permeability, is added into blocking solution for antibody incubation before permeabilization; thus, the permeabilization time of should be specifically optimized.

Q Can I move the Stereo-seq Chip Slide after switching the channels for for mIF imaging?
A
Do not move the Stereo-seq Chip Slide from DAPI imaging to IF imaging. The slide must be kept still until the IF images from all channels are acquired. If Stereo-seq slide has been moved, imaging differences in nuclei-stain and IF images may cause automatic image registration unsuccessful. Moreover, applying a drop of water on the imaging stage prior to positioning the Stereo-seq Chip Slide is critical to the imaging process. This ensures the slide remains stationary during imaging, thereby avoiding any mobile bias.


Q How to avoid fluorophore bleed-through when multiple fluorophores are applied in my Stereo-seq mIF transcriptomics experiment?
A

There are two options.

Option 1: Avoid selecting fluorophores with overlapping wavelengths that may lead to spectral crossover.

Option 2: Replace a microscope to eliminate the risk of channel bleed-through.

Q Why is a brief centrifugation recommended before adding primary, secondary antibodies and DAPI solutions?
A
Brief centrifugation prevents the pipetting of antibodies or dye aggregates that have formed during storage, which can lead to bright spots on the fluorescence image.


Q What are the key points for selecting multiple primary antibodies in Stereo-seq mIF application? Which sources of antibodies have been tested so far?
A

Primary antibodies of different host species should be selected for mixture. Secondary antibody selection depends on the host species of the target primary antibody. So far, only primary antibodies sourced from mouse, rabbit and rat have been tested.


Q What are the key points for drawing hydrophobic circles on the microscopic glass slide with an immunohistochemistry pen?
A
  1. Preparing the Slide: Before drawing the hydrophobic circle, ensure the area around the tissue is completely dry. Use dust-free paper to gently wipe away any liquid from the slide.

  2. Drawing the Circle: While drawing the circle, hold the slide firmly with one hand to prevent it from moving.

  3. Adding liquid: When adding liquid, ensure it is dispensed entirely within the hydrophobic circle, covering the entire tissue. Avoid adding excess liquid, as it may flow outside the circle, making it difficult for the liquid to aggregate within the circle. 4. Removing liquid: place the glass slide on the bench and aspirate most of the liquid out from the tissue, and tilt the glass slide to remove the remaining with dust-free paper.


Q When performing antibody titrations on microscopic glass slides, how many tissue sections can be mounted on one slide?
A

For easier operation, it is recommended to mount only one tissue section per microscopic glass slide.



Q Can antibody titrations be done on used Stereo-seq Chips and how much reagent should be used?
A

Yes, antibody titration can be done on a previously used Stereo-seq chip to help users get familiarized with the transcriptomics experimental workflow with 100 μL of antibody/blocking solution applied per chip.

Q What does the overall image processing procedure of Stereo-seq analysis look like?
A

The image processing workflow is slightly updated after SAW v8.0/StereoMap v4.0.

SAW >= v8.0, StereoMap >= v4.0 (Current)

  • The major image processing steps are: Image registration (including pre-registration) -> Tissue segmentation -> Cell Segmentaion -> Cell border correction -> Extracting gene expression data

Stereo-seq_image_processing_overview_v2 (SAW >=8.0)



SAW < v8.0, StereoMap < v4.0, ImageStudio <= 3.0

  • The major image processing steps are: Image pre-registration -> Tissue segmentation -> Cell Segmentaion -> Image registration -> Cell border correction -> Extracting gene expression data

Stereo-seq_image_processing_overview_v1 (SAW <8.0)



Q Format and requirements of the original input FASTQ file to SAW.
A

STOmics SAW analysis process supports paired FASTQ and group FASTQ files, and suppports Q40 and Q4 quality systems.

  • Paired FASTQs include a pair of read files, read 1 for CID, MID information and read 2 for captured RNA sequencing data respectively. An example of paired FASTQ

  • # read 1
    @E100026571L1C001R00300000000/1
    TGTCCAACGGAGACGGCTCCGACAAGGCACTGGCA
    +
    >DG;<BGH=>*EFE8*G/3E@2:F0-GBGG188F<
    
    # read 2
    @E100026571L1C001R00300000000/2
    GTCTCACCATACTTTTACAAAGTTATTTCAACCCAAATCACAATTTAAGAATTATTTGTTCTACCTATGCCACACTTTAAATAAATGTCTATTAAAACCA
    +
    -GFEECG?ECBFF<=@A@<E@><;FGCF=>=E53FEF5>FGF@,0ADE9CEAG2GBE@HF3EA<CE;G2F@=G8=?@G9FBGE.EG6G2;974E*D9DE9
  • Grouped-FASTQ is an output format with only one read file split from a dataset (containing 16 or 64 parts in a group). Read ID in the file starts with "@" and includes the read name and encoded CID and MID information. The sequence part contains captured RNA sequencing data. The file storage space is greatly reduced because of the combined output format and fewer quality values. An example of grouped FASTQ:

    @FP300000513L1C002R00400000218 CE242DF29A57 97D26
    GTGTAGTGAACCCCATGGTAGTTTTCTGATTGTTGTTAAAAAAAATGACTTAACATATTACATGGACACTCAATAAAAATGTTTTATTTCCTGTTGAAAA
    +
    FFFFFFFFFFFF8F8FFFFFFFFFFFFF8FFFFFFFFF8FF8FFF8FFFFFFF,FFFFFFFFFFF8FFFFFF8F8F,F8FFFFFF,FFFFFFFFFF,FFF

    For more information, please refer to [SAW User Manual > Analysis > Inputs > FASTQs].


    Reach out to Us
    Discover the power of Stereo-seq
    Consult